Mird237 — ^new^
No. While both are used in tissue healing, they act on completely different receptors. MIRD237 targets FGFRs; TB-500 targets actin.
If utilized within medical frameworks (often tied to Medical Internal Radiation Dose calculations or genetic sequencing):
A landmark 2016 study published in the journal Oncogene used the C. elegans vulval cell model to search for miRNAs that could alter a cell's sensitivity to γ-irradiation. The researchers screened several miRNA deletion mutants and identified a clear role for cel-mir-237. mird237
This public link is valid for 7 days and shares a thread, including any personal information you added. This link or copies made by others cannot be deleted. If you share with third parties, their policies apply. Can’t copy the link right now. Try again later.
This gene encodes a stem-loop precursor miRNA that is processed into two functional mature strands: and cel-miR-237-3p (Sequence: CUGUCGAGUUUUGUCAAGGACC) . It's a paralog of the famous lin-4 gene, the first miRNA ever discovered, placing it in a critically important family of regulatory RNAs. If utilized within medical frameworks (often tied to
Depending on your specific industry, "mird237" most likely represents one of four things: a , a deep learning model variant , an internal corporate SKU , or a cybersecurity asset tag .
Thank you for your continued collaboration. Reach out with any urgent questions. This public link is valid for 7 days
: When logging millions of sequential tracking markers (from 001 to 999), partition your physical database storage drives by the alphabetic prefix. This technique limits disk-read times, resulting in much faster application responses.
user wants a long article about "mird237". I need to gather information from various sources to cover its identity, synonyms, functions, roles in diseases, and potential as a biomarker or therapeutic target. I will follow the search plan. search results have provided a good amount of information. I need to open several of these results to gather detailed information. search results have provided information on the identity, homologs, developmental role, radiosensitivity, and potential as a biomarker. I will now structure the article. It will cover what it is, how its homolog shapes human research, its radiation sensitivity mechanism, a broader toolkit for bioscience, and ongoing frontiers and translational prospects. I will use the gathered information to write a comprehensive article. The Enigmatic mir-237: A Tiny RNA with Big Implications for Cancer, Development, and Beyond
However, the existing body of work is a testament to the power of model organism research. A tiny RNA discovered in a millimeter-long worm is now a candidate biomarker for brain cancer, a potential therapeutic target for breast cancer, and a tool for understanding how environmental stress affects reproduction.